3 determining if a backup is required after unrecoverable operations

Tài liệu Concepts and Administration pptx

Tài liệu Concepts and Administration pptx

Ngày tải lên : 17/01/2014, 06:20
... Similar to a primary database, a standby database can be either a single-instance Oracle database or an Oracle Real Application Clusters database A standby database can be either a physical standby ... standby databases Chapter 3, "Creating a Physical Standby Database" This chapter explains how to create a physical standby database Chapter 4, "Creating a Logical Standby Database" This chapter ... Flashback Database After Issuing an Open Resetlogs Statement" s Flashback Database Support Data Guard supports the new Flashback Database feature that allows a standby database to be quickly and...
  • 474
  • 1.3K
  • 1
báo cáo hóa học: " Onset and persistence of person-perceived participation restriction in older adults: a 3-year follow-up study in the general population" pptx

báo cáo hóa học: " Onset and persistence of person-perceived participation restriction in older adults: a 3-year follow-up study in the general population" pptx

Ngày tải lên : 18/06/2014, 19:20
... substantially to (i) the conception and design of the study, acquisition of data and analysis and interpretation of data, (ii) drafting of this manuscript and have given final approval of this ... the attrition re-weighted analyses The observed data are available in additional file Observed onset and persistence of restriction in any and each aspect of life at three years Page of 11 (page ... The reliability and validity of the KAP have been established as adequate for providing estimates of perceived participation restriction in population studies [34] Statistical analysis Data recorded...
  • 11
  • 498
  • 0
Báo cáo lâm nghiệp: "Evaluation of squared timber and log products in the Hyrcanian Forests of Iran" doc

Báo cáo lâm nghiệp: "Evaluation of squared timber and log products in the Hyrcanian Forests of Iran" doc

Ngày tải lên : 07/08/2014, 10:21
... Located in the northern part of Iran, the study areas are known as the Northern Forests or Hyrcanian Forests and are distributed across three provinces: Golestan, Mazandaran, and Gilan The majority ... monitored at the same time The relationships between squared timber and log products during the last 20 years (1989–2008) were evaluated using statistical software such as SPSS (Statistical Package ... during the last two decades; however, this trend was is not quite regular on a year-by-year basis Table Total squared timber and log products in the study areas in zears 1989–2008 Squared timber...
  • 6
  • 366
  • 0
Tài liệu Báo cáo Y học: Mutations in the docking site for cytochrome c on the Paracoccus heme aa3 oxidase Electron entry and kinetic phases of the reaction pptx

Tài liệu Báo cáo Y học: Mutations in the docking site for cytochrome c on the Paracoccus heme aa3 oxidase Electron entry and kinetic phases of the reaction pptx

Ngày tải lên : 22/02/2014, 07:20
... supernatant after ultracentrifugation was loaded on the first column, a DEAE-Sepharose CL-6B (Pharmacia Biotech) equilibrated with 20 mM potassium phosphate pH 8.0, mM EDTA and 0.5 gÆL)1 dodecyl maltoside ... that both complexes display a basically similar line shape, and turnover numbers are in close agreement at 20 lM cytochrome c This behaviour is taken as a first evidence that the periplasmically ... exponentials The observed rate constant from the fast phase of this double-exponential decay was plotted against the cytochrome c concentration, and the apparent bimolecular rate constant kon calculated...
  • 9
  • 457
  • 1
Báo cáo khóa học: Mutational and computational analysis of the role of conserved residues in the active site of a family 18 chitinase docx

Báo cáo khóa học: Mutational and computational analysis of the role of conserved residues in the active site of a family 18 chitinase docx

Ngày tải lên : 07/03/2014, 14:20
... reaction pathway of cyclodextrin glycosyltransferase elucidate catalysis in the alpha-amylase family Nat Struct Biol 6, 432–436 Terwisscha van Scheltinga, A. C., Armand, S., Kalk, K.H., Isogai, A. , ... 22 pKa calculations pKa values for Asp140, Asp142, Glu144 and Asp215 were calculated in several ChiB mutants as described in Materials and methods (Table 3) Calculations were primarily based ... mutated in this study are shown in Fig Asp140, Asp142, Glu144 and Asp215 were mutated individually to asparagine and alanine, Tyr10 and Tyr214 were replaced by Phe, and Ser93 was replaced by alanine...
  • 10
  • 651
  • 0
Báo cáo khoa học: Local changes in the catalytic site of mammalian histidine decarboxylase can affect its global conformation and stability pptx

Báo cáo khoa học: Local changes in the catalytic site of mammalian histidine decarboxylase can affect its global conformation and stability pptx

Ngày tải lên : 08/03/2014, 08:20
... M., Hara, M., Mai, L., Numayama-Tsuruta, K., Ishigaki-Suzuki, S., Ohuchi, K., Ichikawa, A. , Falus, A. , Watanabe, T & Nagy, A (2001) Mice lacking histidine decarboxylase exhibit abnormal mast cells ... for the catalytic mechanism characterization [19] Substrate analogs capable of blocking the HDC catalytic site at different catalytic steps are known, allowing the detection and analysis of the ... I., Nakajima, Y., Hirotsu, K & Kagamiyama, H (2003) Conformational change in aspartate aminotransferase on substrate binding induces strain in the catalytic group and enhances catalysis J Biol...
  • 12
  • 409
  • 0
Báo cáo khoa học: Kinetic and crystallographic analyses of the catalytic domain of chitinase from Pyrococcus furiosus – the role of conserved residues in the active site pdf

Báo cáo khoa học: Kinetic and crystallographic analyses of the catalytic domain of chitinase from Pyrococcus furiosus – the role of conserved residues in the active site pdf

Ngày tải lên : 15/03/2014, 11:20
... mutations were 5¢-GCCACT TACTTGAACTTTGACATAGAAGCCGG-3¢, 5¢-GCCAC TTACTTGGCATTTGACATAGAAGCC-3¢, 5¢-GCCACT TACTTGGACTTTAACATAGAAGCCGG-3¢, 5¢-GCCAC TTACTTGGACTTTGCGATAGAAGCCGG-3¢, 5¢-GGAC TTTGACATACAAGCCGGTATCGATGC-3¢, ... B-factor values ˚ All atoms (A2 ) ˚ Main-chain (A2 ) ˚ Side-chain (A2 ) ˚ Substrate (A2 ) ˚ Water (A2 ) R.m.s DB values ˚ Main-chain (A2 ) ˚ Side-chain (A2 ) Ramachandran plot statisticsf Favored (%) Allowed ... T, Hirata K, Ishikawa K, Hagihara Y & Uegaki K (2006) Crystallization and X-ray diffraction analysis of a catalytic domain of hyperthermophilic chitinase from Pyrococcus furiosus Acta Crystallogr...
  • 13
  • 514
  • 0
Báo cáo khoa học: Post-translational modifications in the active site region of methyl-coenzyme M reductase from methanogenic and methanotrophic archaea potx

Báo cáo khoa học: Post-translational modifications in the active site region of methyl-coenzyme M reductase from methanogenic and methanotrophic archaea potx

Ngày tải lên : 16/03/2014, 05:20
... of the ANME-1 cluster, there is a codon for a valine, whereas in mcrA from methanogenic archaea, there is a codon for a glutamine [2] 4914 Methanogenic archaea and methanotrophic archaea all belong ... DiSpirito AA, Alterman MA, Galeva N, Larive CK, Asunskis D & Sherwood PM (2004) Methanobactin, a copper-acquisition compound from methane-oxidizing bacteria Science 305, 1612– 1615 33 Hayakawa Y, Sasaki ... demonstrates that methyl-coenzyme M reductase is essential in Methanosarcina acetivorans C 2A and allows isolation of mutants with defects in regulation of the methanol utilization pathway J Bacteriol...
  • 9
  • 548
  • 0
Báo cáo khoa học: Key substrate recognition residues in the active site of a plant cytochrome P450, CYP73A1 ppt

Báo cáo khoa học: Key substrate recognition residues in the active site of a plant cytochrome P450, CYP73A1 ppt

Ngày tải lên : 17/03/2014, 10:20
... 5¢-GTTCGAGAACAATGAATGTTGTGTTC-3¢ 5¢-GAACACAACATTCTCTGTTCTCGAACC-3¢ 5¢-GAAGTTAAAGATACAATGATTCAGCTC 5¢-CATTGTTGAAGACATCAATGTTG-3¢ 5¢-CTTTACATTGTTGAATTCATCAATGTTGCAGC-3¢ 5¢-CATTGTTGAAAACGCTAATGTTGCAG-3¢ ... 5¢-GATACCGATGAGATGGGTGGGCAGTTTAG-3¢ 5¢-CAACATTCCTTGTCATCGAACCAAACTC-3¢ 5¢-GAACACAACATTCATTGTTCTCGAAC-3¢ 5¢-GGTTCGAGAACAGAGAATGTTGTGTTC-3¢ 5¢-GAGCTGAATCATTGTAACTTTAACTTC-3¢ 5¢-CAACATTGATGTCTTCAACAATG-3¢ ... 5¢-CAACATTGATGTCTTCAACAATG-3¢ 5¢-GCTGCAACATTGATGAATTCAACAATGTAAAG-3¢ 5¢-CTGCAACATTAGCGTTTTCAACAATG-3¢ 5¢-CATACGGAGCATGAGGGTTTCCTTG-3¢ 5¢-CGGGATCGCCATTTCGAGACGGAGGG-3¢ 5¢-CGGGATCGCCATAAAGAGACGGAGGG-3¢ 5¢-GACTAGAAGCGGGAACGCCATACGGA-3¢...
  • 12
  • 380
  • 0
Báo cáo Y học: Role of tyrosine 238 in the active site of Rhodotorula gracilis D-amino acid oxidase A site-directed mutagenesis study docx

Báo cáo Y học: Role of tyrosine 238 in the active site of Rhodotorula gracilis D-amino acid oxidase A site-directed mutagenesis study docx

Ngày tải lên : 17/03/2014, 17:20
... assay and gel electrophoresis DAAO activity was assayed with an oxygen electrode at pH 8.5 and 25 C with 28 mM D-alanine as substrate at air oxygen saturation ([O2] 0.253 mM) [14] One DAAO ... Y238F DAAO mutant, consistent with a ternary complex mechanism For Y238S, as well as for wild-type DAAO [24], a parallel line pattern in the secondary plots was found instead Such a behaviour was ... substrates with large, hydrophobic side chains (such as cephalosporin C and D-phenylalanine), as well as for a small and polar amino acid such as D-serine The Y238 mutants have a similar substrate...
  • 10
  • 496
  • 0
Report Development Tools Building Custom Reports in the R/3 System

Report Development Tools Building Custom Reports in the R/3 System

Ngày tải lên : 27/10/2013, 07:15
... Werner Aigner, Simone Baeumer, Tami Becker, Randi Bethel, Sylvia Chaudoir, Muge Das, Elisa Davis, Ray Fan, Sampath Gomatam, Maria Gregg, Darrin Griggy, Reiner Herde, Michael Hielbrink, James Hill, ... Mohamad Hakim (Softline, Inc.) Clare Carver (The Pair Group) Margie Coolidge, Ron Giovannelli, and Patrick Zalamea (Ziatech Corporation) Pamela Anderson and Robert Smith (publishing consultants) ... of SAP AG SAP AG makes no warranties or representations with respect to the content hereof and specifically disclaims any implied warranties of merchantability or fitness for any particular purpose...
  • 16
  • 657
  • 0
Fill in the gaps 3

Fill in the gaps 3

Ngày tải lên : 02/11/2013, 10:20
... writing, and to avoid contractions such as 'isn't' and 'doesn't' k …materials such as nylon as well as natural materials such as cotton l …it is unlikely that man will be able travel to other galaxies ... teaching assistants in order to _ undergraduates a instruct b drill c inform 10 Cigarette packets on sale are required to carry a _ clearly stating the dangers of smoking a label ... refused all food and indeed nearly died in his protest / complaint against British control of his country If you are taking medicine, you should avoid alcohol as the two may interact / cooperate and...
  • 13
  • 650
  • 1
Tài liệu Personal Web Usage in the Workplace: A Guide to Effective Human Resources Management Part 3 docx

Tài liệu Personal Web Usage in the Workplace: A Guide to Effective Human Resources Management Part 3 docx

Ngày tải lên : 24/12/2013, 18:15
... to be able to observe their managers to see what is and is not acceptable behavior within an organizational setting It is important that managers accept and model appropriate Web use behavior ... exploratory factor analysis with varimax rotation was conducted on the 18 measures The factor analysis revealed four factors and explained 64.36% of the variance in the data Table shows the factor loadings ... trust is a stage where each potential interaction between two individuals is assessed as an independent value-based transaction (Coleman, 1990) If the interaction is evaluated as beneficial to...
  • 46
  • 562
  • 0
Tài liệu Color Atlas of Pharmacology (Part 3): Distribution in the Body docx

Tài liệu Color Atlas of Pharmacology (Part 3): Distribution in the Body docx

Ngày tải lên : 22/01/2014, 00:20
... available for exchange are maximal (extensive vascular branching, low velocity of flow) The capillary wall forms the blood-tissue barrier Basically, this consists of an endothelial cell layer and ... bound water structurally bound water 40% 20% 40% intracellular intracellular water water extra-cellular extracellular water water Potential aqueous solvent Potential aqueous spaces for drugs spaces ... organelles (6) or are stored within the latter (7) In these cases, Vapp can exceed the actual size of the available fluid volume The significance of Vapp as a pharmacokinetic parameter is discussed on...
  • 10
  • 475
  • 0
Tài liệu Báo cáo khoa học: The plasminogen activator inhibitor 2 transcript is destabilized via a multi-component 3¢ UTR localized adenylate and uridylate-rich instability element in an analogous manner to cytokines and oncogenes pdf

Tài liệu Báo cáo khoa học: The plasminogen activator inhibitor 2 transcript is destabilized via a multi-component 3¢ UTR localized adenylate and uridylate-rich instability element in an analogous manner to cytokines and oncogenes pdf

Ngày tải lên : 16/02/2014, 09:20
... AGTAAGGAAAATAAGCTTGGGCATGATCCC GCTCACTGCCTAAGCTTTGTAGCTAATAAAG CTTTATTAGCTACAAAGCTTAGGCAGTGAGC CTTTGTTATTTATTATGCATTCCTATGGTGAGTT AACTCACCATAGGAATGCATAATAAATAACAAAG CTTTGTTAAAGCTTATGCATTCCTATGGTGAGTT AACTCACCATAGGAATGCATAAGCTTTAACAAAG ... SJS170 ALS030 SJS209 SJS275 SJS276 CGGAAGATCTAACTAAGCGTGCTGCTTC TACGAGATCTGTTGTTTGGAAGCAGGTT CGGAAGATCTGGGATCATGCCCATTTAG TACGAGATCTTAGCTACATTAAATAGGC GGGATCATGCCCAAGCTTATTTTCCTTACT AGTAAGGAAAATAAGCTTGGGCATGATCCC ... AACTCACCATAGGAATGCATAAGCTTTAACAAAG CCTCTTACACTTGCTTTTGAC GCAAAGGTGCCTTTGAGGTTG GACCCCTTCATTGACCTCAACTA CTTGATTTTGGAGGGATCTC TTAGCTACATTAAATAGGCAG GtaatacgactcactataGGGATCATGCCCATTTAG Forward (nt 1281–1298...
  • 14
  • 635
  • 0
Tài liệu Báo cáo khoa học: Neuronal growth-inhibitory factor (metallothionein-3): evaluation of the biological function of growth-inhibitory factor in the injured and neurodegenerative brain pdf

Tài liệu Báo cáo khoa học: Neuronal growth-inhibitory factor (metallothionein-3): evaluation of the biological function of growth-inhibitory factor in the injured and neurodegenerative brain pdf

Ngày tải lên : 16/02/2014, 15:20
... However, as GIF has been localized both intracellularly and extracellularly, it may have an important role in metal-related extracellular neurochemistry It is important to note that the GIF is able ... of GIF in AD There are numerous pathological hallmarks in AD that are commonly accompanied by neuronal alterations These physical alterations include aberrant neurite sprouting and significant ... is altered in a transgenic murine model of familial amyotrophic lateral sclerosis Exp Neurol 162, 27–36 Yamada M, Hayashi S, Hozumi I, Inuzuka T, Tsuji S & Takahashi H (1996) Subcellular localization...
  • 9
  • 664
  • 0
Tài liệu Báo cáo khoa học: Activation loop 3 and the 170 loop interact in the active conformation of coagulation factor VIIa pdf

Tài liệu Báo cáo khoa học: Activation loop 3 and the 170 loop interact in the active conformation of coagulation factor VIIa pdf

Ngày tải lên : 18/02/2014, 08:20
... the lack of a transmembrane region, i.e an inability to dramatically lower the Km, it cannot exert the same dramatic impact on FX activation When G372AFVIIa was bound to lipidated TF, FX activation ... N-terminal pegylation of G37 2A- FVIIa and FVIIa (A) Pegylation of free and TF-bound G37 2A- FVIIa and FVIIa visualized by SDSPAGE At each time point, a 12 lL aliquot of the reaction mixture was removed, ... kinetic parameters were calculated by global tting of binding data to a : model using the software Biaevaluation 4.1 supplied by the manufacturer (Biacore AB) N-terminal pegylation and carbamylation...
  • 11
  • 619
  • 0
Tài liệu Báo cáo khoa học: A novel coupled enzyme assay reveals an enzyme responsible for the deamination of a chemically unstable intermediate in the metabolic pathway of 4-amino-3-hydroxybenzoic acid inBordetellasp. strain 10d doc

Tài liệu Báo cáo khoa học: A novel coupled enzyme assay reveals an enzyme responsible for the deamination of a chemically unstable intermediate in the metabolic pathway of 4-amino-3-hydroxybenzoic acid inBordetellasp. strain 10d doc

Ngày tải lên : 19/02/2014, 16:20
... NADPH, and glutamate dehydrogenase were from Wako Pure Chemicals (Osaka, Japan); meat extract (Extract Ehlrich) was from Kyokuto Seiyaku Kogyo (Osaka, Japan); and pentafluorophenylhydrazine was from ... of 2-aminomuconate deaminases [6,8,27] or to any other sequences available in FASTA and BLAST database programs at the DNA Data Bank of Japan Recently, we reported the cloning and sequencing ... Murakami, S & Shinke, R (1997) Partial purification and characterization of a bacterial dioxygenase that catalyzes the ring fission of 2-aminophenol Microbiol Res 152, 33–38 10 Takenaka, S., Asami,...
  • 7
  • 613
  • 1
Tài liệu Báo cáo khoa học: Involvement of two positively charged residues of Chlamydomonas reinhardtii glyceraldehyde-3-phosphate dehydrogenase in the assembly process of a bi-enzyme complex involved in CO2 assimilation doc

Tài liệu Báo cáo khoa học: Involvement of two positively charged residues of Chlamydomonas reinhardtii glyceraldehyde-3-phosphate dehydrogenase in the assembly process of a bi-enzyme complex involved in CO2 assimilation doc

Ngày tải lên : 19/02/2014, 16:20
... PsativumA SoleraceaA 197 Chlamy 200 Synechocystis 198 Synechococcus 199 R R R R R R R R R R R R R R R R R R R R A A A A A A A A A A R R R R R R R R R R A A A A A A A A A A A A A A A A A A A A A ... T T T T T G G G G G G G G G G A A A A A A A A A A A A A A A A A A A A K K K K K K K K K K A A A A A A A A A A V V V V V V V V V V S S S S A A A S A A L L L L L L L L L L V V V V V V V V V V L ... D A A A A A A A A A A S S S S S S S S S S H H H H H H H H H H R R R R R R R R R R D D D D D D D D D D L L L L L L L L L L AthalianaB 199 199 PativumB SoleraceaB 199 NtabacumB 199 A. thalianaA...
  • 8
  • 494
  • 0